Introduction

Nextflow handles job submissions on SLURM or other environments, and supervises running the jobs. Thus the Nextflow process must run until the pipeline is finished. We recommend that you put the process running in the background through screen / tmux or similar tool. Alternatively you can run nextflow within a cluster job submitted your job scheduler. Finally, you can use nextflow -bg flag to execute nextflow in background.

It is recommended to limit the Nextflow Java virtual machines memory. We recommend adding the following line to your environment (typically in ~/.bashrc or ~./bash_profile):

NXF_OPTS='-Xms1g -Xmx4g'

Running the pipeline

The typical command for running the pipeline is as follows:

nextflow run nf-core/viralrecon --input samplesheet.csv --genome 'NC_045512.2' -profile docker

This will launch the pipeline with the docker configuration profile. See below for more information about profiles.

Note that the pipeline will create the following files in your working directory:

work # Directory containing the nextflow working files
results # Finished results (configurable, see below)
.nextflow_log # Log file from Nextflow
# Other nextflow hidden files, eg. history of pipeline runs and old logs.

Updating the pipeline

When you run the above command, Nextflow automatically pulls the pipeline code from GitHub and stores it as a cached version. When running the pipeline after this, it will always use the cached version if available - even if the pipeline has been updated since. To make sure that you’re running the latest version of the pipeline, make sure that you regularly update the cached version of the pipeline:

nextflow pull nf-core/viralrecon

Reproducibility

It is a good idea to specify a pipeline version when running the pipeline on your data. This ensures that a specific version of the pipeline code and software are used when you run your pipeline. If you keep using the same tag, you’ll be running the same version of the pipeline, even if there have been changes to the code since.

First, go to the nf-core/viralrecon releases page and find the latest version number - numeric only (eg. 1.3.1). Then specify this when running the pipeline with -r (one hyphen) - eg. -r 1.3.1.

This version number will be logged in reports when you run the pipeline, so that you’ll know what you used when you look back in the future.

Main arguments

-profile

Use this parameter to choose a configuration profile. Profiles can give configuration presets for different compute environments.

Several generic profiles are bundled with the pipeline which instruct the pipeline to use software packaged using different methods (Docker, Singularity, Conda) - see below.

We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported.

The pipeline also dynamically loads configurations from https://github.com/nf-core/configs when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to see if your system is available in these configs please see the nf-core/configs documentation.

Note that multiple profiles can be loaded, for example: -profile test,docker - the order of arguments is important! They are loaded in sequence, so later profiles can overwrite earlier profiles.

If -profile is not specified, the pipeline will run locally and expect all software to be installed and available on the PATH. This is not recommended.

  • docker
  • singularity
  • conda
    • Please only use Conda as a last resort i.e. when it is not possible to run the pipeline with Docker or Singularity.
    • A generic configuration profile to be used with Conda
    • Pulls most software from Bioconda
  • test
    • A profile with a complete configuration for automated testing
    • Includes links to test data so needs no other parameters

--input

You will need to create a samplesheet with information about the samples you would like to analyse before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row as shown in the examples below.

--input '[path to samplesheet file]'

Format

The sample identifiers have to be the same when you have re-sequenced the same sample more than once (e.g. to increase sequencing depth). The pipeline will perform the analysis in parallel, and subsequently merge them when required.

A final design file may look something like the one below. SAMPLE_1 was sequenced twice in Illumina PE format, SAMPLE_2 was sequenced once in Illumina SE format, and SRR11605097, GSM4432381 and ERX4009132 need to be downloaded from the ENA/SRA before the main pipeline execution.

sample,fastq_1,fastq_2
SAMPLE_1,AEG588A1_S1_L002_R1_001.fastq.gz,AEG588A1_S1_L002_R2_001.fastq.gz
SAMPLE_1,AEG588A1_S1_L003_R1_001.fastq.gz,AEG588A1_S1_L003_R2_001.fastq.gz
SAMPLE_2,AEG588A2_S4_L003_R1_001.fastq.gz,
SRR11605097,,
GSM4432381,,
ERX4009132,,
Column Description
sample Custom sample name or database identifier. This entry will be identical for multiple sequencing libraries/runs from the same sample.
fastq_1 Full path to FastQ file for Illumina short reads 1. File has to be gzipped and have the extension “.fastq.gz” or “.fq.gz”.
fastq_2 Full path to FastQ file for Illumina short reads 2. File has to be gzipped and have the extension “.fastq.gz” or “.fq.gz”.

Supported public repository ids

The pipeline has been set-up to automatically download and process the raw FastQ files from public repositories. Currently, the following identifiers are supported:

SRA ENA GEO
SRR11605097 ERR4007730 GSM4432381
SRX8171613 ERX4009132 GSE147507
SRS6531847 ERS4399630
SAMN14689442 SAMEA6638373
SRP256957 ERP120836
SRA1068758 ERA2420837
PRJNA625551 PRJEB37513

If SRR/ERR run ids are provided then these will be resolved back to their appropriate SRX/ERX ids to be able to merge multiple runs from the same experiment.

The final sample information for all identifiers is obtained from the ENA which provides direct download links for FastQ files as well as their associated md5 sums. If download links exist, the files will be downloaded by FTP otherwise they will be downloaded using parallel-fastq-dump.

--protocol

Specifies the type of protocol used for sequencing i.e. ‘metagenomic’ or ‘amplicon’ (Default: ‘metagenomic’).

--amplicon_bed

If the --protocol amplicon parameter is provided then iVar is used to trim amplicon primer sequences after read alignment and before variant calling. iVar uses the primer positions relative to the viral genome supplied in --amplicon_bed to soft clip primer sequences from a coordinate sorted BAM file. The file must be in BED format as highlighted below:

NC_045512.2 30 54 nCoV-2019_1_LEFT 60 -
NC_045512.2 385 410 nCoV-2019_1_RIGHT 60 +
NC_045512.2 320 342 nCoV-2019_2_LEFT 60 -
NC_045512.2 704 726 nCoV-2019_2_RIGHT 60 +

--amplicon_fasta

If the --protocol amplicon parameter is provided then Cutadapt is used to trim amplicon primer sequences from FastQ files before de novo assembly. This file must contain amplicon primer sequences in Fasta format and is mandatory when --protocol amplicon is specified. An example is shown below:

>nCoV-2019_1_LEFT
ACCAACCAACTTTCGATCTCTTGT
>nCoV-2019_1_RIGHT
CATCTTTAAGATGTTGACGTGCCTC
>nCoV-2019_2_LEFT
CTGTTTTACAGGTTCGCGACGT
>nCoV-2019_2_RIGHT
TAAGGATCAGTGCCAAGCTCGT
>nCoV-2019_3_LEFT
CGGTAATAAAGGAGCTGGTGGC
>nCoV-2019_3_RIGHT
AAGGTGTCTGCAATTCATAGCTCT

SRA download

--save_sra_fastq

Save FastQ files created from SRA identifiers in the results directory (Default: false).

--skip_sra

Skip steps involving the download and validation of FastQ files using SRA identifiers (Default: false).

Reference genomes

--genome

This parameter allows you to provide a key for the viral genome you would like to use with the pipeline. To run the pipeline, you must specify which to use with the --genome flag.

Note that you can use the same configuration setup to save sets of reference files for your own use. See the Nextflow documentation for instructions on where to save such a file.

The syntax for this reference configuration is as follows:

params {
// Genome reference file paths
genomes {
'NC_045512.2' {
fasta = "<path to the genome Fasta file>"
gff = "<path to the genome annotation GFF file>"
}
'MN908947.3' {
fasta = "<path to the genome Fasta file>"
gff = "<path to the genome annotation GFF file>"
}
// Any number of additional genomes, key is used with --genome
}
}

You can find the keys to specify the genomes in the Genomes config file.

--fasta

Full path to Fasta file containing reference genome for the viral species (mandatory if --genome is not specified). If you don’t have a Bowtie2 index available this will be generated for you automatically. Combine with --save_reference to save Bowtie2 index for future runs.

--fasta '[path to Fasta reference]'

--gff

Full path to viral GFF annotation file (Default: false).

--save_reference

If the Bowtie2 index is generated by the pipeline use this parameter to save it to your results folder. These can then be used for future pipeline runs, reducing processing times (Default: false).

Kraken 2

--kraken2_db

Full path to Kraken 2 database built from host genome (Default: ‘https://zenodo.org/record/3738199/files/kraken2_human.tar.gz’).

--kraken2_db_name

Name for host genome as recognised by Kraken 2 when using the kraken2 build command (Default: ‘human’).

--kraken2_use_ftp

Option for Kraken 2 using ftp download instead of rsync (Default: false).

--save_kraken2_fastq

Save the host and viral FastQ files in the results directory (Default: false).

--skip_kraken2

Skip Kraken 2 process for removing host classified reads (Default: false).

Read trimming

--cut_mean_quality

The mean quality requirement option shared by fastp cut_front, cut_tail or cut_sliding options. Range: 1~36 (Default: 30 (Q30)).

--qualified_quality_phred

The quality value that a base is qualified. Default 30 means phred quality >=Q30 is qualified (Default: 30).

--unqualified_percent_limit

Percentage of bases that are allowed to be unqualified (0~100) (Default: 10).

--min_trim_length

Reads shorter than this length after trimming will be discarded (Default: 50).

--skip_adapter_trimming

Skip the adapter trimming step performed by fastp. Use this if your input FastQ files have already been trimmed outside of the workflow or if you’re very confident that there is no adapter contamination in your data (Default: false).

--skip_amplicon_trimming

Skip the amplicon trimming step performed by Cutadapt. Use this if your input FastQ files have already been trimmed outside of the workflow or if you’re very confident that there is no primer sequence contamination in your data (Default: false).

--save_trimmed

By default, trimmed FastQ files will not be saved to the results directory. Specify this flag (or set to true in your config file) to copy these files to the results directory when complete (Default: false).

Variant calling

--callers

Specify which variant calling algorithms you would like to use. Available options are varscan2, ivar and bcftools (Default: ‘varscan2,ivar,bcftools’).

--ivar_exclude_reads

This option unsets the -e parameter in ivar trim to discard reads without primers (Default: false).

--filter_dups

Remove duplicate reads from alignments as identified by picard MarkDuplicates (Default: false). Note that unless you are using UMIs it is not possible to establish whether the fragments you have sequenced were derived via true biological duplication (i.e. sequencing independent template fragments) or as a result of PCR biases introduced during the library preparation.

--filter_unmapped

Remove unmapped reads from alignments (Default: false).

--min_base_qual

When performing variant calling skip bases with baseQ/BAQ smaller than this number (Default: 20).

--min_coverage

When performing variant calling skip positions with an overall read depth smaller than this number (Default: 10).

--max_allele_freq

Maximum allele frequency threshold for filtering variant calls (Default: 0.8).

--save_align_intermeds

By default, intermediate BAM files will not be saved. The final BAM files created after the appropriate filtering step are always saved to limit storage usage. Set to true to also save other intermediate BAM files (Default: false).

--save_mpileup

Save Pileup files in the results directory. These tend to be quite large so are not saved by default (Default: false).

--skip_markduplicates

Skip picard MarkDuplicates step (Default: false).

--skip_snpeff

Skip SnpEff and SnpSift annotation of variants (Default: false).

--skip_variants_quast

Skip generation of QUAST aggregated report for consensus sequences (Default: false).

--skip_variants

Specify this parameter to skip all of the variant calling and mapping steps in the pipeline (Default: false).

De novo assembly

--assemblers

Specify which assembly algorithms you would like to use. Available options are spades, metaspades, unicycler and minia (Default: ‘spades,metaspades,unicycler,minia’).

--minia_kmer

Kmer size to use when running minia (Default: 31).

--skip_blast

Skip blastn of assemblies relative to reference genome (Default: false).

--skip_abacas

Skip ABACAS process for assembly contiguation (Default: false).

--skip_plasmidid

Skip assembly report generation by PlasmidID (Default: false).

--skip_vg

Skip variant graph creation and variant calling relative to reference genome (Default: false).

--skip_assembly_quast

Skip generation of QUAST aggregated report for assemblies (Default: false).

--skip_assembly

Specify this parameter to skip all of the de novo assembly steps in the pipeline (Default: false).

Skipping QC steps

The pipeline contains a large number of quality control steps. Sometimes, it may not be desirable to run all of them if time and compute resources are limited. The following options make this easy:

Step Description
--skip_fastqc Skip FastQC
--skip_picard_metrics Skip Picard CollectMultipleMetrics and CollectWgsMetrics
--skip_multiqc Skip MultiQC
--skip_qc Skip all QC steps except for MultiQC

Job resources

Automatic resubmission

Each step in the pipeline has a default set of requirements for number of CPUs, memory and time. For most of the steps in the pipeline, if the job exits with an error code of 143 (exceeded requested resources) it will automatically resubmit with higher requests (2 x original, then 3 x original). If it still fails after three times then the pipeline is stopped.

Custom resource requests

Wherever process-specific requirements are set in the pipeline, the default value can be changed by creating a custom config file. See the files hosted at nf-core/configs for examples.

If you are likely to be running nf-core pipelines regularly it may be a good idea to request that your custom config file is uploaded to the nf-core/configs git repository. Before you do this please can you test that the config file works with your pipeline of choice using the -c parameter (see definition below). You can then create a pull request to the nf-core/configs repository with the addition of your config file, associated documentation file (see examples in nf-core/configs/docs), and amending nfcore_custom.config to include your custom profile.

If you have any questions or issues please send us a message on Slack.

AWS Batch specific parameters

Running the pipeline on AWS Batch requires a couple of specific parameters to be set according to your AWS Batch configuration. Please use -profile awsbatch and then specify all of the following parameters.

--awsqueue

The JobQueue that you intend to use on AWS Batch.

--awsregion

The AWS region in which to run your job. Default is set to eu-west-1 but can be adjusted to your needs.

--awscli

The AWS CLI path in your custom AMI (Default: /home/ec2-user/miniconda/bin/aws).

Please make sure to also set the -w/--work-dir and --outdir parameters to a S3 storage bucket of your choice - you’ll get an error message notifying you if you didn’t.

Other command line parameters

--outdir

The output directory where the results will be saved.

--email

Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (~/.nextflow/config) then you don’t need to specify this on the command line for every run.

--email_on_fail

This works exactly as with --email, except emails are only sent if the workflow is not successful.

--max_multiqc_email_size

Threshold size for MultiQC report to be attached in notification email. If file generated by pipeline exceeds the threshold, it will not be attached (Default: 25MB).

-name

Name for the pipeline run. If not specified, Nextflow will automatically generate a random mnemonic.

This is used in the MultiQC report (if not default) and in the summary HTML / e-mail (always).

NB: Single hyphen (core Nextflow option)

-resume

Specify this when restarting a pipeline. Nextflow will used cached results from any pipeline steps where the inputs are the same, continuing from where it got to previously.

You can also supply a run name to resume a specific run: -resume [run-name]. Use the nextflow log command to show previous run names.

NB: Single hyphen (core Nextflow option)

-c

Specify the path to a specific config file (this is a core NextFlow command).

NB: Single hyphen (core Nextflow option)

Note - you can use this to override pipeline defaults.

--custom_config_version

Provide git commit id for custom Institutional configs hosted at nf-core/configs. This was implemented for reproducibility purposes (Default: master).

## Download and use config file with following git commid id
--custom_config_version d52db660777c4bf36546ddb188ec530c3ada1b96

--custom_config_base

If you’re running offline, Nextflow will not be able to fetch the institutional config files from the internet. If you don’t need them, then this is not a problem. If you do need them, you should download the files from the repo and tell nextflow where to find them with the custom_config_base option. For example:

## Download and unzip the config files
cd /path/to/my/configs
wget https://github.com/nf-core/configs/archive/master.zip
unzip master.zip
## Run the pipeline
cd /path/to/my/data
nextflow run /path/to/pipeline/ --custom_config_base /path/to/my/configs/configs-master/

Note that the nf-core/tools helper package has a download command to download all required pipeline files + singularity containers + institutional configs in one go for you, to make this process easier.

--max_memory

Use to set a top-limit for the default memory requirement for each process. Should be a string in the format integer-unit. eg. --max_memory '8.GB'

--max_time

Use to set a top-limit for the default time requirement for each process. Should be a string in the format integer-unit. eg. --max_time '2.h'

--max_cpus

Use to set a top-limit for the default CPU requirement for each process. Should be a string in the format integer-unit. eg. --max_cpus 1

--plaintext_email

Set to receive plain-text e-mails instead of HTML formatted.

--monochrome_logs

Set to disable colourful command line output and live life in monochrome.

--multiqc_config

Specify a path to a custom MultiQC configuration file.