2.2.4). The latest stable release is2.4.1.Introduction
protocol
This option indicates the experimental protocol used for the sample preparation. Currently supporting:
- ‘illumina’: adapter (
TGGAATTCTCGGGTGCCAAGG) - ‘nextflex’: adapter (
TGGAATTCTCGGGTGCCAAGG), clip_r1 (4), three_prime_clip_r1 (4`) - ‘qiaseq’: adapter (
AACTGTAGGCACCATCAAT) - ‘cats’: adapter (
GATCGGAAGAGCACACGTCTG), clip_r1(3) - ‘custom’ (where the user can indicate the
three_prime_adapter,clip_r1andthree_prime_clip_r1manually)
⚠️ At least the custom protocol has to be specified, otherwise the pipeline won’t run. In case you specify the custom protocol, ensure that the parameters above are set accordingly or the defaults will be applied. If you want to auto-detect the adapters using fastp, please set --three_prime_adapter to "".
mirtrace_species or mirgenedb_species
It should point to the 3-letter species name used by miRBase or MirGeneDB. Note the difference in case for the two databases.
miRNA related files
Different parameters can be set for the two supported databases. By default miRBase will be used with the parameters below.
mirna_gtf: If not supplied by the user, thenmirna_gtfwill point to the latest GFF3 file in miRbase:https://mirbase.org/download/CURRENT/genomes/${params.mirtrace_species}.gff3mature: points to the FASTA file of mature miRNA sequences.https://mirbase.org/download/CURRENT/mature.fahairpin: points to the FASTA file of precursor miRNA sequences.https://mirbase.org/download/CURRENT/hairpin.fa
If MirGeneDB should be used instead it needs to be specified using --mirgenedb and use the parameters below .
mirgenedb_gff: The data can not be downloaded automatically (URLs are created with short term tokens in it), thus the user needs to supply the gff file for either his species, or all species downloaded fromhttps://mirgenedb.org/download. The total set will automatically be subsetted to the species specified with--mirgenedb_species.mirgenedb_mature: points to the FASTA file of mature miRNA sequences. Download fromhttps://mirgenedb.org/download.mirgenedb_hairpin: points to the FASTA file of precursor miRNA sequences. Download fromhttps://mirgenedb.org/download. Note that MirGeneDB does not have a dedicatedhairpinfile, but thePrecursor sequencesare to be used.
Genome
fasta: the reference genome FASTA filebt_indices: points to the folder containing thebowtie2indices for the genome reference specified byfasta. Note: if the FASTA file infastais not the same file used to generate thebowtie2indices, then the pipeline will fail.
Contamination filtering
This step has, until now, only been tested for human data. Unexpected behaviour can occur when using it with a different species.
Contamination filtering of the sequencing reads is optional and can be invoked using the filter_contamination parameter. FASTA files with
rrna: Used to supply a FASTA file containing rRNA contamination sequence.trna: Used to supply a FASTA file containing tRNA contamination sequence. e.g.http://gtrnadb.ucsc.edu/genomes/eukaryota/Hsapi38/hg38-tRNAs.facdna: Used to supply a FASTA file containing cDNA contamination sequence. e.g.ftp://ftp.ensembl.org/pub/release-86/fasta/homo_sapiens/cdna/Homo_sapiens.GRCh38.cdna.all.fa.gzThe FASTA file is first compared to the available miRNA sequences and overlaps are removed.ncrna: Used to supply a FASTA file containing ncRNA contamination sequence. e.g.ftp://ftp.ensembl.org/pub/release-86/fasta/homo_sapiens/ncrna/Homo_sapiens.GRCh38.ncrna.fa.gzThe FASTA file is first compared to the available miRNA sequences and overlaps are removed.pirna: Used to supply a FASTA file containing piRNA contamination sequence. e.g. The FASTA file is first compared to the available miRNA sequences and overlaps are removed.other_contamination: Used to supply an additional filtering set. The FASTA file is first compared to the available miRNA sequences and overlaps are removed.
Samplesheet input
You will need to create a samplesheet with information about the samples you would like to analyse before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 2 columns (“sample” and “fastq_1”), and a header row as shown in the examples below.
If a second fastq file is provided using another column, the extra data are ignored by this pipeline. The smRNA species should be sufficiently contained in the first read, and so the second read is superfluous data in this smRNA context.
--input '[path to samplesheet file]'Multiple runs of the same sample
The sample identifiers should match between runs of resequenced samples. The pipeline will concatenate the raw reads before performing any downstream analysis. Below is an example for the same sample sequenced across 3 lanes:
sample,fastq_1CONTROL_REP1,AEG588A1_S1_L002_R1_001.fastq.gzCONTROL_REP1,AEG588A1_S1_L003_R1_001.fastq.gzCONTROL_REP1,AEG588A1_S1_L004_R1_001.fastq.gzFull samplesheet
The pipeline will auto-detect whether a sample is single- or paired-end using the information provided in the samplesheet. The samplesheet can have as many columns as you desire. However, there is a strict requirement for the first 3 columns to match those defined in the table below.
A final samplesheet file consisting of both single- and paired-end data may look something like the one below. This is for 6 samples, where TREATMENT_REP3 has been sequenced twice.
sample,fastq_1CONTROL_REP1,AEG588A1_S1_L002_R1_001.fastq.gzCONTROL_REP2,AEG588A2_S2_L002_R1_001.fastq.gzCONTROL_REP3,AEG588A3_S3_L002_R1_001.fastq.gzTREATMENT_REP1,AEG588A4_S4_L003_R1_001.fastq.gzTREATMENT_REP2,AEG588A5_S5_L003_R1_001.fastq.gzTREATMENT_REP3,AEG588A6_S6_L003_R1_001.fastq.gzTREATMENT_REP3,AEG588A6_S6_L004_R1_001.fastq.gz| Column | Description |
|---|---|
sample |
Custom sample name. This entry will be identical for multiple sequencing libraries/runs from the same sample. Spaces in sample names are automatically converted to underscores (_). |
fastq_1 |
Full path to FastQ file for Illumina short reads 1. File has to be gzipped and have the extension “.fastq.gz” or “.fq.gz”. |
An example samplesheet has been provided with the pipeline.
Running the pipeline
The typical command for running the pipeline is as follows:
nextflow run nf-core/smrnaseq --input ./samplesheet.csv --outdir ./results --genome GRCh37 -profile dockerThis will launch the pipeline with the docker configuration profile. See below for more information about profiles.
Note that the pipeline will create the following files in your working directory:
work # Directory containing the nextflow working files<OUTDIR> # Finished results in specified location (defined with --outdir).nextflow_log # Log file from Nextflow# Other nextflow hidden files, eg. history of pipeline runs and old logs.If you wish to repeatedly use the same parameters for multiple runs, rather than specifying each flag in the command, you can specify these in a params file.
Pipeline settings can be provided in a yaml or json file via -params-file <file>.
Do not use -c <file> to specify parameters as this will result in errors. Custom config files specified with -c must only be used for tuning process resource specifications, other infrastructural tweaks (such as output directories), or module arguments (args).
The above pipeline run specified with a params file in yaml format:
nextflow run nf-core/smrnaseq -profile docker -params-file params.yamlwith params.yaml containing:
input: './samplesheet.csv'outdir: './results/'genome: 'GRCh37'<...>You can also generate such YAML/JSON files via nf-core/launch.
Updating the pipeline
When you run the above command, Nextflow automatically pulls the pipeline code from GitHub and stores it as a cached version. When running the pipeline after this, it will always use the cached version if available - even if the pipeline has been updated since. To make sure that you’re running the latest version of the pipeline, make sure that you regularly update the cached version of the pipeline:
nextflow pull nf-core/smrnaseqReproducibility
It is a good idea to specify a pipeline version when running the pipeline on your data. This ensures that a specific version of the pipeline code and software are used when you run your pipeline. If you keep using the same tag, you’ll be running the same version of the pipeline, even if there have been changes to the code since.
First, go to the nf-core/smrnaseq releases page and find the latest pipeline version - numeric only (eg. 1.3.1). Then specify this when running the pipeline with -r (one hyphen) - eg. -r 1.3.1. Of course, you can switch to another version by changing the number after the -r flag.
This version number will be logged in reports when you run the pipeline, so that you’ll know what you used when you look back in the future.
Stand-alone scripts
The bin directory contains some scripts used by the pipeline which may also be run manually:
edgeR_miRBase.r: R script using for processing reads counts of mature miRNAs and miRNA precursors (hairpins). This version number will be logged in reports when you run the pipeline, so that you’ll know what you used when you look back in the future. For example, at the bottom of the MultiQC reports.
To further assist in reproducbility, you can use share and re-use parameter files to repeat pipeline runs with the same settings without having to write out a command with every single parameter.
If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles.
Core Nextflow arguments
These options are part of Nextflow and use a single hyphen (pipeline parameters use a double-hyphen).
-profile
Use this parameter to choose a configuration profile. Profiles can give configuration presets for different compute environments.
Several generic profiles are bundled with the pipeline which instruct the pipeline to use software packaged using different methods (Docker, Singularity, Podman, Shifter, Charliecloud, Apptainer, Conda) - see below.
We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported.
The pipeline also dynamically loads configurations from https://github.com/nf-core/configs when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to see if your system is available in these configs please see the nf-core/configs documentation.
Note that multiple profiles can be loaded, for example: -profile test,docker - the order of arguments is important!
They are loaded in sequence, so later profiles can overwrite earlier profiles.
If -profile is not specified, the pipeline will run locally and expect all software to be installed and available on the PATH. This is not recommended, since it can lead to different results on different machines dependent on the computer enviroment.
test- A profile with a complete configuration for automated testing
- Includes links to test data so needs no other parameters
docker- A generic configuration profile to be used with Docker
singularity- A generic configuration profile to be used with Singularity
podman- A generic configuration profile to be used with Podman
shifter- A generic configuration profile to be used with Shifter
charliecloud- A generic configuration profile to be used with Charliecloud
apptainer- A generic configuration profile to be used with Apptainer
conda- A generic configuration profile to be used with Conda. Please only use Conda as a last resort i.e. when it’s not possible to run the pipeline with Docker, Singularity, Podman, Shifter, Charliecloud, or Apptainer.
-resume
Specify this when restarting a pipeline. Nextflow will use cached results from any pipeline steps where the inputs are the same, continuing from where it got to previously. For input to be considered the same, not only the names must be identical but the files’ contents as well. For more info about this parameter, see this blog post.
You can also supply a run name to resume a specific run: -resume [run-name]. Use the nextflow log command to show previous run names.
-c
Specify the path to a specific config file (this is a core Nextflow command). See the nf-core website documentation for more information.
Custom configuration
Resource requests
Whilst the default requirements set within the pipeline will hopefully work for most people and with most input data, you may find that you want to customise the compute resources that the pipeline requests. Each step in the pipeline has a default set of requirements for number of CPUs, memory and time. For most of the steps in the pipeline, if the job exits with any of the error codes specified here it will automatically be resubmitted with higher requests (2 x original, then 3 x original). If it still fails after the third attempt then the pipeline execution is stopped.
To change the resource requests, please see the max resources and tuning workflow resources section of the nf-core website.
Custom Containers
In some cases you may wish to change which container or conda environment a step of the pipeline uses for a particular tool. By default nf-core pipelines use containers and software from the biocontainers or bioconda projects. However in some cases the pipeline specified version maybe out of date.
To use a different container from the default container or conda environment specified in a pipeline, please see the updating tool versions section of the nf-core website.
Custom Tool Arguments
A pipeline might not always support every possible argument or option of a particular tool used in pipeline. Fortunately, nf-core pipelines provide some freedom to users to insert additional parameters that the pipeline does not include by default.
To learn how to provide additional arguments to a particular tool of the pipeline, please see the customising tool arguments section of the nf-core website.
nf-core/configs
In most cases, you will only need to create a custom config once. However, if multiple users within an organisation intend to run nf-core pipelines regularly under the same settings, then consider uploading your custom config file to the nf-core/configs git repository. Before uploading, ensure that the config file works with your pipeline of choice using the -c parameter. You can then create a pull request to the nf-core/configs repository with the addition of your config file, associated documentation file (see examples in nf-core/configs/docs), and amended nfcore_custom.config to include your custom profile.
See the main Nextflow documentation for more information about creating your own configuration files.
If you have any questions or issues please send us a message on Slack on the #configs channel.
Azure Resource Requests
To be used with the azurebatch profile by specifying the -profile azurebatch.
We recommend providing a compute params.vm_type of Standard_D16_v3 VMs by default but these options can be changed if required.
Note that the choice of VM size depends on your quota and the overall workload during the analysis. For a thorough list, please refer the Azure Sizes for virtual machines in Azure.
Running in the background
Nextflow handles job submissions and supervises the running jobs. The Nextflow process must run until the pipeline is finished.
The Nextflow -bg flag launches Nextflow in the background, detached from your terminal so that the workflow does not stop if you log out of your session. The logs are saved to a file.
Alternatively, you can use screen / tmux or similar tool to create a detached session which you can log back into at a later time.
Some HPC setups also allow you to run nextflow within a cluster job submitted your job scheduler (from where it submits more jobs).
Nextflow memory requirements
In some cases, the Nextflow Java virtual machines can start to request a large amount of memory.
We recommend adding the following line to your environment to limit this (typically in ~/.bashrc or ~./bash_profile):
NXF_OPTS='-Xms1g -Xmx4g'